Life Everlasting
The information presented here comes from several books: Signature in the Cell: DNA and the Evidence of Intelligent Design, Darwin’s Doubt, Return of the God Hypothesis, and many others. These books lay out comprehensive arguments, pros, and cons of the origin of life. My readings of these books and others, along with my faith, led to the point of view expressed here.
Opening the Science Door
Until recently science was reluctant to challenge theories or express new ones that hinted at Intelligent Design either because of interpretation of scientific standards or when mainstream science arbitrarily dictated there was no such thing as intelligent Design science —it was considered faith. Scientists had to tiptoe around theories that implied religion.
Throughout history, scientists have been guilty of stifling science. Most famously, Galileo Galilei’s proof the Earth evolved around the sun was shunned not just by the Church but also by other scientists of the day. Scientists wouldn’t even look through the telescope to see the proof. He was tried by the Inquisition and forced to recant or face the gallows and shun the required tenants of science to be dynamic not static, open to hypothesis, testing, debate, and criticism. Scientists today don’t face the gallows for their claims but the near corporal punishment of lack of funding, careers, censorship, and isolation from peers and journals serves a similar purpose.
The origin of life debate might be as old as Genesis. The scientific intelligent design debate door now seems to have been opened because of an article promoting a theory of intelligent design published in the reputable Smithsonian Institution journal. It was not so much the content of the article but the punishment and mistreatment of the editor who published the article. This caused an awakening to the long-standing resistance of science to any new science proposed that proved intelligent design. The snowball began to roll and grow into an avalanche defending science even mainstream investigations by the O’Reilly Factor. About the same time, the American Civil Liberties Union (ACLU) also announced a suit against a school board in the western Pennsylvania town of Dover to prevent it from teaching intelligent design harkening back to the Scopes Monkey Trial, 1925. Since then, credible scientists have stepped forward to offer theories and evidence to support intelligent design.
Intelligent Design
What first piqued my interest in the book Signature of the Cell, was the author, Stephen Myers’, theory and presented facts that, “There are tell-tale features of living systems and the universe that are best explained by an intelligent cause—that is, by the conscious choice of a rational agent—rather than by an undirected process.” A puzzle piece that called to me was that design implies information is needed to direct the process to originate and sustain life, or in the absence of information, life must have had a material origin and no evidence has ever been presented that life, especially the complicated life of humans arises out of inert matter.
The information needed to create and sustain life, including environmental demands, requires an unfathomably large amount of information. The magnitude of information required of a designer is unimaginable but so does accidental creation when I consider the calculations of the Oxford mathematician and physicist Roger Penrose, Nobel Laureate in Physics and Professor of Mathematics. He calculated the probability of chance creation of a universe like ours, with so many unique requirements for life, is one part in 1010123. “The little number has so many zeroes that if each zero was a centimeter wide, the full number would stretch across the entire visible universe trillions of times over, “and even then, would only just barely be getting started.”
Ostensibly, light years away from plugging a television into a wall and viewing information was the discovery of the DNA double helix by James Watson and Francis Crick. According to the National Human Genome Research Institute, NHGRI, the genetic code found in all DNA, “refers to the instructions contained in a gene that tells a cell how to make a specific protein. Each gene’s code uses the four nucleotide bases of DNA: adenine (A), cytosine (C), guanine (G) and thymine (T), in various ways to spell out three-letter “codons” that specify which amino acid is needed at each position within a protein.”
Is it magic there is information in living cells that triggers certain cells to become brain cells and others to become heart cells at just the right time and throughout our lives? In my book. Guts of Life, “From the time we are a fetus to the day we are born, life rushes forward as the number of connections, called synapses increases from 50 trillion to one quadrillion. After that first swat on the butt when we suck in our first breath, we exhale 25 sextillion molecules of oxygen, and every person who lives from now until the sun burns out will from time to time breathe in a bit of you. Heinz Pagel in the book Cosmic Code, revealed, ‘In our last breath it is almost certain we will have inhaled at least one atom from the dying breath of Julius Caesar.’ Our bodies operate twenty-four-seven for decades on water, oxygen and numerous critical chemicals without much in the way of regular servicing. Today we can get spare parts when needed. Our bodies are a universe of 37.2 trillion cells operating in more or less perfect concert. Our eyes distinguish up to a million different colors. Our hearing can differentiate properties of sounds–volume, timbre, duration, etc. Our brains interpret billions of optic and audible signals as danger, beautiful sunsets, loving smiles, and the music of your favorite new-age artist.”
Communicating Life Creation Information
Beyond the consideration that thought is required for creating life, how is thought communicated, and in what form is it useful for creation? Our experiences recognize that great achievements invariably reflect the prior activity of intelligent persons. Transfer of the genius of those achievements is passed in word language from one generation to another and advances civilization. It raises a question about the qualitative value of any information unless it is conveyed and used. So, how is the complexity of designing life communicated in a format that is duplicatable, sustainable, and functional?
DNA stores and transmits the blueprint and assembly instructions to create and sustain the miraculous us, but how does it communicate? Are there communications within DNA molecules that say when to act and how to act? Is our genetic code like computer code? Hubert Yockey, an American physicist and information theorist, theorizes that “genetic code is constructed to confront and solve the problems of communication and recording by the same principles found…in modern communication and computer codes.”
All of this creation work is performed in DNA molecules that are approximately 2 nanometers (nm) wide, (One nanometer is equal to one billionth of a meter). The DNA strand is about 2 meters long and the total length of all the DNA in our body would be about twice the diameter of the Solar System. Evidence of the power of nano is biblical. The mustard seed is 1 to 2 millimeters in diameter considered one of the smallest seeds in the world, and under the right condition, in soil with a little water can grow as big as a few feet tall.
The digital code of computers is based on a binary number system in which there are only two possible states, off and on, usually symbolized by 1 and 0.
The following is an example of binary code from the book, Signature in the Cell: DNA and the Evidence for Intelligent Design, by Stephen C Meyer. Don’t think about the following numbers as numbers. They represent a positive 0 and a negative 1.
These are the first words of the Declaration of Independence (“When in the course of human events…”).
01010111011010000110010101101110001000000110100101
1011100010000001110100011010000110010100100000010
0001101101111011101010111001001110011011001010010
00000110111101100110001000000110100001110101011011
0101100001011011100010000001100101011101100110010
1011011100111010001110011001000000110100101110100
This array of alpha characters for DNA looks a lot like computer code.
AGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGC
CGAGTACACCGAGGGGTGAGGCGCGGGCCGGGGCTAGGGGCTGAGTCCGC
CGTGGGGCGCGGGCCGGGGCTGGGGGCTGAGTCCGCCCTGGGGTGCGCGC
CGGGGCGGGAGGCGCAGCGCTGCCTGAGGCCAGCGCCCCATGAGCAGCT
TCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
The letters are a representation of actual instructions for building a protein machine. The A T G C, are the chemical components of the DNA bases –(A) adenine, (C) cytosine, (G)guanine or (T) thymine. They are the building blocks of the DNA molecules –the letters of the genetic code. Knowing this does not answer how genetic code came into existence, by accident randomly, or by design. And it does not answer how the information is communicated. Until great inquisitive scientific minds or the GREAT Scientist himself reveals the why and how we are left to have our own opinions.
What About the Soul?
To me, our SOUL is who we are at our core, our spiritual being, uniquely created by God. If we eliminate the material aspects of this life, discard the ever-changing opinions of the world around us, and remove the expectations of others and ourselves, our soul will still exist.
There is another question that further investigations might reveal an answer. Our soul is our essence, which is the truth of us created through a lifetime of memories and deeds. As we advance our knowledge of life’s origin, we may also learn about our very souls. We may learn that our essence is accumulated in coded life experiences that live indestructibly within and outside of us for eternity.
We exist in an energy field of particles or waves that make up everything at the deepest level and there is growing evidence as to how information computation and storage interact to facilitate consciousness. Do our brains possess an AI-like capability that codifies our essence? Our brains and AI can summarize almost instantaneously great volumes of data. We store in our brains vast amounts of information that we accumulate in our lives. Our brain can hold and retrieve up to 2.5 petabytes (PB), or one quadrillion bytes.
According to current estimates, the internet contains around 64 Zettabytes of data, with predictions that this number will reach 181 Zettabytes by 2025. Our brains can hold 2.5 petabytes and the internet currently 64 Zettabytes. 1 Zettabyte = 1,000,000 Petabytes (one million Petabytes). So the brain holds only a tiny fraction of what the internet holds—(about 0.0000000000138%).
Do we need 2.5 Petabytes of information to codify our essence? It seems unnecessary and impractical for our essence to include everything stored in a brain. Not all of the thoughts and deeds of Hitler or Mother Teressa are required to write the code their souls.
Perhaps our authentic self is coded in a similar manner to Artificial Intelligence (AI) which has a computational power much greater than humans and can process data faster and more accurately. However, the AI computational limit today is more related to the volume of data to be analyzed or summarized. Analyzing large volumes of data can slow the process and reduce accuracy. This will be resolved by quantum computing. However, computational speed may be unnecessary to gathering and sorting information to generate and preserve our essence which evolves over a lifetime.
